HIV is a complex animal virus
AIDS
The animal virus HIV infects certain key cells of the immune system, destroying the ability of the body to defend itself from cancer and disease.
The HIV infection cycle is typically a lytic cycle, in which the HIV RNA first directs the production of a corresponding DNA, and this DNA then directs the production of progeny virus particles. The Future of HIV Treatment.
Combination therapies and chemokines offer promising avenues of AIDS therapy.
What is Disease Viruses ? Who are they?
Humans have known and feared diseases caused by viruses for thousands of years. Among the diseases that viruses cause are influenza, smallpox, infectious hepatitis, yellow fever, polio, rabies, and AIDS, as well as many other diseases not as well known. In addition, viruses have been implicated in some cancers and leukemias. For many autoimmune diseases, such as multiple sclerosis and rheumatoid arthritis, and for diabetes, specific viruses have been found associated with certain cases.
In view of their effects, it is easy to see why the late Sir Peter Medawar, Nobel laureate in Physiology or Medicine, wrote, “A virus is a piece of bad news wrapped in protein.”
Viruses not only cause many human diseases, but also cause major losses in agriculture, forestry, and in the productivity of natural ecosystems.
What is Viroids?
=>
Viroids are tiny, naked molecules of RNA, only a few hundred nucleotides long, that are important infectious disease agents in plants. A recent viroid outbreak killed over ten million coconut palms in the Philippines. It is not clear how viroids cause disease. One clue is that viroid nucleotide sequences resemble the sequences of introns within ribosomal RNA genes. These sequences are capable of catalyzing excision from DNA—perhaps the viroids are catalyzing the destruction of chromosomal integrity.
what is Terminal Deoxy Nucleotidyl Transferase ?
Terminal transferase is an unusual DNA polymerase found only in prelymphocytes and in early staqes of lymphoid differentiation. Synthesis of single stranded tails at the 3’ ends of either single stranded DNA or double stranded DNA with protruding 3’ termini, by the enzyme Terminal Deoxy Nucleotidyl Transferase, is called tailing, can be used to generate protruding ends of defined sequence to facilitate cloning of fragments. It can be used to generate protruding ends of defined sequence, e.g poly A tails on the 3’ ends of the DNA insert and poly T tails on 3’ ends of the vector. Thus, the protruding ends of the DNA insert and vector will base pair under appropriate annealing conditions. Mg2+ cation is preferred when the nucleotide to be added is a purine while Co2+ is preferred for the addition of pyrimidines. The enzyme strongly prefers DNA with protruding 3’ terminus, although blunt or recessed 3’ termini are also used, but less efficiently, in buffers of low ionic strength with Co2+, Mg2+ or Mn2+ as bivalent cations. As many as thousands of deoxynucleotides can be incorporated using this enzyme on a template of DNA. Single nucleotide can be added to the 3’ termini of DNA if modified bases like dideoxynucleotides or cordycepin triphosphates are used instead of natural deoxynucleotide triphosphates.
What is Screening, Genetic Tests and Counseling of Cancer?
Early diagnosis of cancer greatly increases survival; therefore, regular exams for cancer can help to prevent deaths from cancer. These include mammograms and Pap tests for women, prostate cancer tests for men, colonoscopy exams for colon cancer, and regular physical exams for other types of cancer. Individuals with a strong family history of cancer should consider genetic tests for cancer and cancer risk counseling. The focus of cancer risk counseling is the individual’s personal risk of developing cancer and appropriate actions based on that risk. The discovery of the BRCA1and BRCA2genes associated with early development of breast cancer has allowed women with a family history of early breast cancer to be tested for mutations in these genes. Only five to ten percent of breast cancers show evidence of inheritance. Of these, forty-five percent are associated with a mutation in BRCA1and thirty-five percent with BRCA2. The gene or genes for the remaining twenty percent are not yet known. If the BRCA1 and BRCA2test results are negative, there is no evidence that the woman will have breast cancer because of these mutations. However, she may get breast cancer because of somatic mutations in these or other genes. If the BRCA1 orBRCA2test is positive, other family members may be tested to determine whether the gene was inherited. If other family members are negative, then there is less chance of hereditary risk of this form of cancer, although the individual with the mutation does carry an increased risk of the disease. If the test is positive in other family members, there is an increased hereditary risk for breast cancer in that family. The absence of hereditary risk does not mean that there is no other risk for breast cancer. Decisions based on genetic tests can be very complicated. Individuals must be fully informed about the risks before they can make reasonable decisions. Genetic counselors are trained to help individuals make difficult decisions based on genetic tests. The cumulative risk of breast cancer to age seventy for a woman with a BRCA1mutation is about fifty-seven to eighty-five percent depending on whether she is in a high-risk family. Some women find the fear of cancer so disruptive to their lives that they choose mastectomy to prevent cancer. (This is called prophylactic mastectomy.) Similarly, women with BRCA1have a high lifetime risk of ovarian cancer, causing some of them to choose to have their ovaries removed. While these are difficult decisions, the availability of genetic information provides individuals with information that they can use to make such important medical decisions. A young woman with a strong family history of ovarian cancer might find by genetic testing that she does not have the BRCA1 mutation and should not consider removal of her ovaries.
What is Follicle in Human fertilization? Development if follicle.
Follicle cells (from sex cords) surround the Primary oocyte.
The Follicle is the oocyteplus follicle cells
Primordial follicle -follicle cellspartially surround oocyte
Primary follicle –follicle cells form a complete layer Follicle cells form gap junctions with the oocyteand produce Meiotic inhibitory factor.
Follicle cells are called granulosacells
Granulosacell layer enclosed by the membranagranulosa, a basement membrane that acts as a barrier to capillaries.
Zona pellucidasecreted by oocyteand
follicle cells –with microvillarconnections between the two.
Ovary cells form 2 more layers –theca interna, theca external.
Follicle Development
Secondary follicle –formation of the antrum(cavity) fluid filled, liquor folliculi Hormone production, androgens and estrogen.
Tertiary or Graffianfollicle–12 hours prior to ovulation.
cumulus oophorus= mound of cells that house the secondary oocyte.
Oogenesiscontrolled by cycles (Menstrual) of hormone release: Hypothalamus to gonadotropinreleasing hormone(GnRH) Anterior to pituitary Gonadotropins, includesluteinizing hormone(LH)
and Follicle stimulating hormone(FSH)
Ovulation -tertiary follicle protrudes like a blister on the surface of the ovary –then bursts in response to LH and FSH.
Corpus Luteum–Follicle after ovulation –hormone producing Progessterone.
What is Bacteriophage Artificial Chromosomes (BACs) ?
These plasmids are circular DNA molecules carrying conventional antibiotic resistance marker, origin of replication derived from the F factor of E.coli, an ATP driven helicase (repE) to facilitate DNA replication and three loci (parA, parB and parC) for proper partitioning of the plasmid to daughter cells. BAC vectors have no packing constraints and there is no fixed limit to the size of genomic DNA that they accept. Usually the size of DNA is approximately 120-kilo base pairs.
Yeast Artificial Chromosome (YACs)
These are linear DNA molecules similar to yeast chromosome. Recombinant YACs are made by ligating large fragments of genomic DNA and then the resultant plasmid is introduced into yeast by transformation. The vector carries selection marker, DNA sequences called as telomere, so that the product can be stabilized inside the yeast cell, an origin of replication called autonomous replication origin, ARS. Large size of DNA can be inserted into YAC vectors, usually between 250kilobases to 400kilobasepairs. Large size of mammalian genomic libraries is also made with approximately 1 megabasepairs of foreign inserts. Insertion of foreign DNA into the cloning site inactivates a mutant expressed in vector DNA and formation of red rather than white colonies by yeast strain is observed. Thus transformants are identified as red colonies, which grow in yeast that is mutant for TRP1 and URA3, which ensure that the cell has received an artificial chromosome and with both the telomeres since it is complimented for both the mutations. And the colony also contains foreign DNA because it is red in color.
What is plant vector ?
Plant Vectors
A vector is a circular DNA molecule capable of independent existence and replication within a host cell. In case of plants, Ti and Ri are the two most commonly used plasmids which are used as vectors. Plant cells as such do not possess any endogenous plasmids. But two plasmids called pTi and pRi, are present naturally in the bacteria, Agrobacterium tumefaciens and Agrobacterium rhizogenes, respectively. These plasmids provide a naturally occurring transformation system. A part of the plasmid DNA, called as T-DNA, is transferred into the genomes of most dicot and some monocot plants. pTi stands for tumor inducing plasmid and pRi stands for root inducing plasmid. The infection of Agrobacterium tumefaciens is mediated by transfer of a segment of pTi called as T-DNA into the plant cell. Various bacterial chromosomal genes, such as chvB, exo genes, cell genes, are concerned with the biosynthesis of cell attachment polysaccharides due to which the bacterial cells adhere firmly to the plant cells. While two chromosomal genes are expressed constitutively in bacterial cells that is expressed at all the times inside a cell, which are responsible for virulence associated aspects, Agrobacterium tumefaciens Ti plasmid produces tumor like growth from which roots / shots may sometimes be produced. The infected cells are able to grow in culture on a medium devoid of any growth regulator while uninfected normal plant cells need exogenous auxin or cytokinin. These plasmids also carry genes for IAA (Indole Acetic Acid - auxin) and cytokinin production which is the reason for indefinite growth on a growth regulator free culture medium. When pTi is introduced into Rhizobium trifolii, it gains the ability to produce galls and to utilize opines. The crown gall root cells also synthesize unique nitrogenous compounds called opines, which are not produced by normal plant cells, which are not infected, nor are they utilized. The infected cells use opines as their carbon and nitrogen source. The type of opine produced depends on the bacterial strain. Agrobacterium tunefaciens strain produces either octopine or nopaline which the Agrobacterium rhizogenes produce either agropine or mannopine.
Brief note about Ti plasmid
=>
Ti plasmid is a large mega plasmid conjugative plasmid of ~200kb. pTi is lost when Agrobacterium is grown above 28oC, such cured bacteria do not induce crown galls that is, they become a virulent. pTi and pRi, although do not share sequence homology but are unique in following respects:- a) They contain some genes, which are located within their T-DNA which has regulatory sequences recognized by plant cells, while their remaining genes have prokaryotic regulatory sequences. As a result, the former are expressed only in plant cells but not in the Agrobacterium, while the latter are only expressed in the bacterium. b) These plasmids naturally transfer a part of their DNA, called as T-DNA, into host plant cells. The T-DNA usually contains following important functional regions.
1. T-DNA contains oncogenes and opine synthesis genes and is transferred into host plant.
2. Vir region which regulates the transfer of T-DNA
3. Opine catabolism genes for utilization of opines.
4. Origin of replication for propagation in Agrobacterium. The T-DNA contains a 24bp direct repeat border sequence and contains the genes necessary for tumor / possess gene for auxin and cytokinin biosynthesis. All the genes present in TDNA have eukaryotic regulatory sequences. As a result, these genes are expressed only in plant cells but never express in Agrobacterium. The vir region mediates the transfer of TDNA into plant genomes and hence is essential for virulence. The genes of vir region are not transferred but induce the transfer of T-DNA. Also, the genes present in T-DNA are not responsible for its transfer, but the 24 bp direct repeat at both the left and right ends of TDNA is essential for the transfer. The exact mechanism of transfer of T-DNA is not known clearly known but is brought by the vir region. The phenols produced by wounded plant tissue initiates the transfer process. The T-DNA is transferred into the plant cells as single stranded DNA, which increases the efficiency of its transformation. But, as soon as it enters into the plant cell, it is immediately converted into a double stranded form. This form integrates at random sites in the host plant genome by a phenomenon called illegitimate recombination, which are due to sequence of homology in short segments of the host DNA. This integration is usually in low copy numbers. Few vectors are derived from pTi (wild type) due to some problems posed by wild type plasmid eg. The presence of oncogenes causes a disorganized growth, their large size and lack of cloning sites within the T-DNA, which are needed for the insertion of DNA segments that has to be cloned.
What is Disarming ? Or removal of oncogenes from T-DNA into plant cell.
What is the Common Method of gene transfar?
Disarming is the removal of oncogenes from T-DNA and it has resolved many problems. This disarmed plasmid can still transfer its T-DNA into plant cells. But the cells containing this modified T-DNA will be non tumorous, produce opines and generate plantlets. Only the border sequences are necessary for the transfer of any DNA insert placed between them. Thus pTi and pRi which are disarmed are more in use for gene transfer experiments. But in some plants, the efficiency of transformation by disarmed pTi is much lower than the wild type pTi. Introduction of DNA into plant cells without the involvement of a biological agent like Agrobacterium leading to a stable transformation is known as Direct Gene Transfer. The spontaneous uptake of DNA is quite low.
The various methods those are utilized for direct gene transfer are
1. Chemical methods like PEG, Calcium phosphate
2. Electroporation
3. Particle gun delivery
4. Lipofection
5. Microinjection and Macroinjection
Application of Klenow fragment in Molecular Biology
1. Synthesis of double stranded DNA from single stranded template The primary function of DNA polymerase is to synthesize complimentary strands during DNA replication. DNA polymerase requires a primer to provide 3’–OH group to which newer nucleotides can be added. The primers used are generally 6-20 bases in length, termed as oligonucleotides, which are complimentary to a specific region of template DNA.
Shown below is the display of the catalytic activity carried out by the enzyme.
GCTAC AGGC AAGTCCGATGCCAATTGCGGATCCGATT
Klenow fragment ||| dNTPs of each kind |||
|||
\\||//
\ /
GCTACGGTTAACGCCTAGGCTAA AAGTCCGATGCCAATTGCGGATCCGATT
2. Filling in recessed 3’ends of DNA fragments Klenow fragment is also used to create blunt ends on fragments created by restriction enzymes that leave 5’ overhangs. Klenow and dNTPs of 5’AGGCAG3’
3’TCCGTCGAACT5’ ||| || klenow fragment
|||
\\||//
\ /
5’AGGCAGCTTGA3’
3’TCCGTCGAACT5’
This is another way of producing blunt ends on a DNA, which is created by restriction enzymes that produce 3’ overhangs. Removal of nucleotides from 3’ ends will continue, but in the presence of nucleotides, the polymerase activity balances the exonuclease activity, yielding blunt ends.
4. Generating novel cohesive ends The DNA digested with restriction enzymes generates cohesive ends that can be end-filled. The end-filling reaction can be controlled by omitting one, two or three of the four dNTPs from the reaction and thereby generate partially filled termini.
What is the Conditions and requirements that influence Enzyme Activity for the use of Restriction Endonuclease at the time of treatment with plasmid ?
One unit activity :-
it is defined as amount of enzyme required to digest 1µg of reference DNA in 60 minutes at 370C. Usually reference DNA is λ phage DNA.
Buffer:-
The most critical determinant of the enzyme activity is the ionic concentration (NaCl content) of the buffer. There are commercially 3 buffer systems available for the activity, low salt buffer (20mM), medium (100mM) or high (250mM) NaCl buffers. The buffer is usually 10mM Tris-HCl, pH 8.0, supplemented with Magnesium salt (often 50mM MgCl2), a reducing agent (usually 1mM DTT), and some enzymes require BSA (100µg/ml) and salt (NaCl). The reaction does not require ATP.
Quality of DNA :-
Preparation of DNA that has to be cleaved should be free of contaminants such as phenol, CHCl3, alcohol, EDTA, detergents, excessive salts, protein, RNA, all of which can pose a hindrance to the enzyme’s activity.
Stopping a Reaction :
To terminate Restriction enzymes activity, heat inactivation is a way but for the enzymes which it does not work, phenol / CHCl3 extraction is another means of inactivation of Restriction enzymes.
Incubation Temperature and Time : -
Recommended temperature for most of the Restriction enzymes is 370C except for the ones which are isolated from thermophilic bacteria which require higher temperature ranging from 50-650C. While some restriction enzymes have short ½ lives at 370C and for those lower temperatures are required. Incubation time as per the unit definition is 1 hour but it can be manipulated. Example, it may be shortened if more units of Restriction enzyme is added or longer times are used to allow a reaction to proceed to completion with fewer enzymes units.
What is Electrophoresis buffer?
Several different buffers have been recommended for electrophoresis of DNA. The most commonly used for duplex DNA are TAE (Tris-acetateEDTA) and TBE (Tris-borate-EDTA). DNA fragments will migrate at somewhat different rates in these two buffers due to differences in ionic strength. Buffers not only establish a pH, but provide ions to support conductivity. If water is used instead of buffer there will be no migration of DNA in the gel and conversely, if concentrated buffer is used like a 10X solution instead of 1X, heat will be generated in the gel which is enough to melt it.
What is Isochizomers?
Isochizomers are different Restriction endonucleases having same recognition site. In some cases, they cut identically within their recognition site, but sometime they do not. They have different optimum reaction conditions, stabilities and cost that give us an option of what to purchase. Some Restriction endonucleases recognizes only one sequence but never other, called as Ambiguous Recognition Sequence. Eg. BamH I recognize GGATCC, while Hinf I recognizes a 5bp sequence, with an eligibility of sequence starting with GA and ending with TC and having any base in between GANTC. Some REs recognition site has a site for cleavage by other Restriction Endonuclease. e.g: BamH I site GGATCC have site recognized and cleaved by Sau3A I GATC. Thus all BamH I sites can consequently be cut by Sau3A I.
What is Ethidium bromide?
Answer- Ethidium bromide is a fluorescent dye that intercalates between bases of nucleic acids and allows very convenient detection of DNA fragments in gels. It is added to the DNA sample before loading to enable visualization of the fragments within the gel or can be added in the electrophoresis buffer. The binding of ethidium bromide to DNA alters its mass and rigidity, and therefore its mobility.
What is phage ?
PHAGE can also replicate via the Lysogenic cycle. The phage genome is integrated into the host chromosome and is inherited into the chromosomes of all daughter bacteria. This "prophage" can be induced to enter the lytic cycle and kill its host by a variety of stresses like UV light
What is Bacteriophage ?
Bacteriophages replicate via the lytic phase cycle and the phage genome is injected into the cell, phage genes are expressed and phage proteins and DNA are made, progeny phage are packaged, and the cell is lysed. Two genetically different phage that infect the same host cell may recombine during the lytic cycle
What is a Recombinant DNA ?
DNA molecules constructed outside the living cells that is in vitro by joining natural or synthetic DNA segments that can replicate in a living cell.
What is the Goals of Recombinant DNA Technology?
a) To isolate and characterize a gene
b) To make desired alterations in one or more isolated genes
c) To return altered genes to living cells
What is Basic Tools of Recombinant DNA Technology?
Nucleic Acid Enzymes DNA and RNA polymerases, reverse transcriptase, DNA ligases, Restriction endonucleases and many more.
