Taq DNA polymerase

Taq DNA polymerase:-


  Taq DNA polymerase is a DNA dependent DNA polymerase, first isolated from the hot spring bacterium, Thermus aquatics in 1976 and in 1989. Due to its wide use in molecular biology (primarily PCR), it is termed as ‘Molecule of the Year’. This thermophilic DNA polymerase encodes an 832-amino acid, 94 kDa protein, which consists of two domains.

1. -NH2 domain:  Similar to 5’-3’ exonuclease domain of members of polymerase I family of DNA polymerase

2. -C terminal domain contains a catalytically inactive 3’-5’ exonuclease and a polymerase sub domain, similar to klenow of DNA polymerase I.

The thermal stability of Taq DNA polymerase is attributed to its hydrophobic core and stable electrostatic interactions and high density of proline residues on the surface of the enzyme.

The optimal activity is at 75-800C temperature and at 600C, the activity is reduced by a factor of 2 and at 370C, its activity is reduced to only 10%.

To initiate DNA synthesis, like other DNA polymerases, it also requires a primer that is annealed to the template strand and caries an extensible 3’-OH group.

Taq DNA polymerase requires Mg2+ for its optimal activity. Phosphate buffers inhibit Taq DNA polymerase and therefore should be avoided. The reaction is usually carried out in the presence of Tris buffer at pH 8.3. Because of the lack of a proofreading function, the rate of misincorporation of dNTPs is high in PCR reactions which are catalyzed by Taq polymerase (or any other DNA polymerase that does not have editing domains).
Several mutant forms of native polymerases, are also available like Pfu And vent. Both of them have proofreading activities contributed by 3’-5’ exonuclease.

 Pfu polymerase is therefore known to generate lowest errors while vent is probably intermediate between Taq and Pfu.

 Pfu polymerase is isolated from Pyrococus furiosus Vent is isolated from Thermococcus litoralis (also known as Tli polymerase) 

T7 DNA Polymerase

T7 DNA Polymerase



 The T7 DNA polymerase from T7 bacteriophage has 3’-5’ exonuclease and DNA polymerase activity but lacks 5’-3’ exonuclease domain, which is similar to T4 DNA polymerase. The processivity of this enzyme is quite good that is, the average length of DNA synthesized before the enzyme dissociates from the template, is considerably greater than for other enzymes. Thus, the average length of DNA synthesized by a single molecule of bacteriophage T7 polymerase is much greater than that of DNAs synthesized by other DNA polymerases. The binding and polymerization domain is occupied by the carboxy terminus while the potent 3’-5’exonuclease activity resides on the amino terminus.

The exonuclease activity is completed inactivated by incubating the enzyme with a reducing agent, molecular oxygen, and low concentrations of ferrous ions, for several days. Over 99% of the exonuclease activity is abolished without affecting the polymerization activity by these agents, which cause mutations and site specific modifications. The resulting chemically modified enzyme is marketed under the trade name Sequenase is ideal for determining the sequence of long tracts of DNA by the dideoxy mediated chain termination method. 

PCR Mediated Gene Cloning

PCR Mediated Gene Cloning

 There are three strategies for cloning PCR products-

 1) T/A cloning is the easiest cloning method. T/A cloning takes advantage of the terminal transferase activity of Taq polymerase and other non-proofreading DNA polymerases which adds a single 3'-A overhang to each end of the PCR product. The resulting PCR product is then ligated into a linear vector with a 3´ terminal 'T' or 'U' at both ends.

 2) Directional cloning. A restriction enzyme target site is introduced into each of the PCR primers. The resulting PCR product and cloning vector are digested with the restriction enzymes to generate complementary ends at the PCR product and the vector which are then ligated.

  3) Blunt-end cloning-Blunt-end PCR product generated by proof-reading polymerase such as the Pfu DNA Polymerase can also be cloned into a blunt-end vector.

The cloning of PCR-amplified fragments into a linear vector is typically a rapid and efficient process. However, not all PCR fragments will clone with the same efficiency into the same vector. These differences may be due to fragment size, insert toxicity, and the complexity of the insert. The size of the fragment being cloned is a primary contributor to the overall cloning efficiency. Large fragments of DNA (≥ 5 kb) are amenable to cloning in high-copy number vectors, yet at a much lower efficiency. Optimization of molar concentration ratios of the vector to insert is critical to ensure efficient cloning. Successful cloning ratios may range from 1:1 to 1:10. For example, if the vector is 3 kb and the insert is 1 kb, one-third the amount of insert needs to be added to attain a 1:1 molar ratio.  

Alkaline Phosphatase (AP

 Alkaline Phosphatase (AP)


Alkaline Phosphatase is an important tool in molecular biological processes like cloning. It removes 3’- phosphate groups from a variety of substrates. Although in laboratory, it is used to catalyze the removal of terminal 5’-(P), residues from single stranded or double stranded DNA and RNA. The resulting 5’-OH termini can no longer take part in ligation reactions, thus prevents self religation of vectors, reducing the background of transformed bacterial colonies that carry empty plasmids. This enzyme works optimally at alkaline pH (range of 89 in the presence of low Zn+2 concentrations) and hence derived the name.  Alkaline Phosphatase is isolated from various sources:-

 a) Bacterial Alkaline phosphatase Secreted in monomeric form into the Periplasmic space of E.coli, where it form dimers and gets catalytically activated. It’s a remarkably stable enzyme and is resistant to inactivation by heat and detergent. Thus, bacterial alkaline phosphatase is the most difficult to destroy in the reaction mix.

b) Calf Intestinal Phosphatase  Calf intestinal phosphatase is a dimeric glycoprotein isolated from bovine intestine. This has much more practical significance than bacterial alkaline phosphatase, since it can be readily inactivated from the reaction mixture using proteinase K or by heating at 650C for 30 minutes or 750C for 15 minutes in the presence of 10mM EGTA.

c) Shrimp alkaline phosphatase Extracted from cold water shrimp, can be inactivated readily by heating at 650C for 15 min. 

what is Shuttle vector in gene cloning ?

What is Shuttle vector in gene cloning ?

Cloning of foreign DNA is usually carried out primarily in E.coli since the organism is most thoroughly studied. But subsequent work often requires the foreign segment to be delivered to different host cells like eukaryotes. A number of vectors are devised to satisfy this requirement. These vectors are termed as shuttle vectors. These vectors have origins of replication of various hosts. The also contain fragments of eukaryotic viruses to facilitate entry into the cell or expression or integration in the cell itself. Thus shuttle vectors allow DNA to be transferred between two different species where it can be propagated by utilizing both the origins of replication. Usually the origins of replication are derived from bacterial and eukaryotic systems. Shuttle vectors also carry antibiotic resistance genes, which are functional in eukaryotes e.g. Neomycin (G418), Hygromycin, Methotrexate etc. All the DNA manipulation and characterization are done in prokaryotic system and then the manipulated DNA is introduced into the eukaryotic systems for protein expression and functional analysis. Eukaryotic host systems are better for expression of protein for few reasons:

1. Proper folding of the protein to attain functional activity .

2. Posttranslational modification of proteins for which prokaryotes does not possess any machinery. The most conventional and convenient model system for expression of eukaryotic proteins is yeast, Pichia pastoris, which is both genetically and physiologically well characterized. 

Application of klenow fragment in Molecular Biology

Application of Klenow fragment in Molecular Biology

1. Synthesis of double stranded DNA from single stranded template The primary function of DNA polymerase is to synthesize complimentary strands during DNA replication. DNA polymerase requires a primer to provide 3’–OH group to which newer nucleotides can be added. The primers used are generally 6-20 bases in length, termed as oligonucleotides, which are complimentary to a specific region of template DNA.

Shown below is the display of the catalytic activity carried out by the enzyme.

GCTAC                              AGGC AAGTCCGATGCCAATTGCGGATCCGATT

                       Klenow fragment       |||                 dNTPs of each kind                                                    |||
                                                           |||
                                                        \\||//
                                                          \ /

                     GCTACGGTTAACGCCTAGGCTAA              AAGTCCGATGCCAATTGCGGATCCGATT

2. Filling in recessed 3’ends of DNA fragments Klenow fragment is also used to create blunt ends on fragments created by restriction enzymes that leave 5’ overhangs. Klenow and dNTPs of             5’AGGCAG3’                       
3’TCCGTCGAACT5’                           |||                                                                                   || klenow fragment
                                                           |||
                                                        \\||//
                                                          \ /                       

                            5’AGGCAGCTTGA3’
                            3’TCCGTCGAACT5’

This is another way of producing blunt ends on a DNA, which is created by restriction enzymes that produce 3’ overhangs. Removal of nucleotides from 3’ ends will continue, but in the presence of nucleotides, the polymerase activity balances the exonuclease activity, yielding blunt ends.

4. Generating novel cohesive ends The DNA digested with restriction enzymes generates cohesive ends that can be end-filled. The end-filling reaction can be controlled by omitting one, two or three of the four dNTPs from the reaction and thereby generate partially filled termini.