Monday, 29 August 2016

HIV is a complex animal virus

HIV is a complex animal virus

AIDS

The animal virus HIV infects certain key cells of the immune system, destroying the ability of the body to defend itself from  cancer and disease.
The HIV infection cycle is typically a lytic cycle, in which the HIV RNA first directs the production of a corresponding DNA, and this DNA then directs the production of progeny virus particles. The Future of HIV Treatment.
Combination therapies and chemokines offer promising avenues of AIDS therapy.

What is Disease Viruses ? Who are they?

What is Disease Viruses ? Who are they?

Humans have known and feared diseases caused by viruses for thousands of years. Among the diseases that viruses cause are influenza, smallpox, infectious hepatitis, yellow fever, polio, rabies, and AIDS, as well as many other diseases not as well known. In addition, viruses have been implicated in some cancers and leukemias. For many autoimmune diseases, such as multiple sclerosis and rheumatoid arthritis, and for diabetes, specific viruses have been found associated with certain cases.

In view of their effects, it is easy to see why the late Sir Peter Medawar, Nobel laureate in Physiology or Medicine, wrote, “A virus is a piece of bad news wrapped in protein.”
Viruses not only cause many human diseases, but also cause major losses in agriculture, forestry, and in the productivity of natural ecosystems.

What is Viroids?

What is Viroids?

=>
Viroids are tiny, naked molecules of RNA, only a few hundred nucleotides long, that are important infectious disease agents in plants. A recent viroid outbreak killed over ten million coconut palms in the Philippines. It is not clear how viroids cause disease. One clue is that viroid nucleotide sequences resemble the sequences of introns within ribosomal RNA genes. These sequences are capable of catalyzing excision from DNA—perhaps the viroids are catalyzing the destruction of chromosomal integrity.

Thursday, 25 August 2016

Taq DNA polymerase

Taq DNA polymerase:-


  Taq DNA polymerase is a DNA dependent DNA polymerase, first isolated from the hot spring bacterium, Thermus aquatics in 1976 and in 1989. Due to its wide use in molecular biology (primarily PCR), it is termed as ‘Molecule of the Year’. This thermophilic DNA polymerase encodes an 832-amino acid, 94 kDa protein, which consists of two domains.

1. -NH2 domain:  Similar to 5’-3’ exonuclease domain of members of polymerase I family of DNA polymerase

2. -C terminal domain contains a catalytically inactive 3’-5’ exonuclease and a polymerase sub domain, similar to klenow of DNA polymerase I.

The thermal stability of Taq DNA polymerase is attributed to its hydrophobic core and stable electrostatic interactions and high density of proline residues on the surface of the enzyme.

The optimal activity is at 75-800C temperature and at 600C, the activity is reduced by a factor of 2 and at 370C, its activity is reduced to only 10%.

To initiate DNA synthesis, like other DNA polymerases, it also requires a primer that is annealed to the template strand and caries an extensible 3’-OH group.

Taq DNA polymerase requires Mg2+ for its optimal activity. Phosphate buffers inhibit Taq DNA polymerase and therefore should be avoided. The reaction is usually carried out in the presence of Tris buffer at pH 8.3. Because of the lack of a proofreading function, the rate of misincorporation of dNTPs is high in PCR reactions which are catalyzed by Taq polymerase (or any other DNA polymerase that does not have editing domains).
Several mutant forms of native polymerases, are also available like Pfu And vent. Both of them have proofreading activities contributed by 3’-5’ exonuclease.

 Pfu polymerase is therefore known to generate lowest errors while vent is probably intermediate between Taq and Pfu.

 Pfu polymerase is isolated from Pyrococus furiosus Vent is isolated from Thermococcus litoralis (also known as Tli polymerase) 

T7 DNA Polymerase

T7 DNA Polymerase



 The T7 DNA polymerase from T7 bacteriophage has 3’-5’ exonuclease and DNA polymerase activity but lacks 5’-3’ exonuclease domain, which is similar to T4 DNA polymerase. The processivity of this enzyme is quite good that is, the average length of DNA synthesized before the enzyme dissociates from the template, is considerably greater than for other enzymes. Thus, the average length of DNA synthesized by a single molecule of bacteriophage T7 polymerase is much greater than that of DNAs synthesized by other DNA polymerases. The binding and polymerization domain is occupied by the carboxy terminus while the potent 3’-5’exonuclease activity resides on the amino terminus.

The exonuclease activity is completed inactivated by incubating the enzyme with a reducing agent, molecular oxygen, and low concentrations of ferrous ions, for several days. Over 99% of the exonuclease activity is abolished without affecting the polymerization activity by these agents, which cause mutations and site specific modifications. The resulting chemically modified enzyme is marketed under the trade name Sequenase is ideal for determining the sequence of long tracts of DNA by the dideoxy mediated chain termination method. 

Insertion Vectors

Insertion Vectors

Vectors that have a single target site for insertion of foreign DNA are known as insertion vectors. 20% DNA that is not required for lytic growth is removed and therefore insertion of foreign DNA resumes the size back to something like its full length and can be packaged in vitro. Maximum size of DNA that can be accommodated varies from 9- 11 kb. For DNA of larger sizes, high capacity vectors are designed like:-

Vector                size.                     OrI                            Host
Cosmid.            30-45kb.           Col E1                           E.coli
BAC.                 120-300kb.          Replicon forgein      E.coli  
YAC                   250-400kb           ARS                            Yeast

PCR Mediated Gene Cloning

PCR Mediated Gene Cloning

 There are three strategies for cloning PCR products-

 1) T/A cloning is the easiest cloning method. T/A cloning takes advantage of the terminal transferase activity of Taq polymerase and other non-proofreading DNA polymerases which adds a single 3'-A overhang to each end of the PCR product. The resulting PCR product is then ligated into a linear vector with a 3´ terminal 'T' or 'U' at both ends.

 2) Directional cloning. A restriction enzyme target site is introduced into each of the PCR primers. The resulting PCR product and cloning vector are digested with the restriction enzymes to generate complementary ends at the PCR product and the vector which are then ligated.

  3) Blunt-end cloning-Blunt-end PCR product generated by proof-reading polymerase such as the Pfu DNA Polymerase can also be cloned into a blunt-end vector.

The cloning of PCR-amplified fragments into a linear vector is typically a rapid and efficient process. However, not all PCR fragments will clone with the same efficiency into the same vector. These differences may be due to fragment size, insert toxicity, and the complexity of the insert. The size of the fragment being cloned is a primary contributor to the overall cloning efficiency. Large fragments of DNA (≥ 5 kb) are amenable to cloning in high-copy number vectors, yet at a much lower efficiency. Optimization of molar concentration ratios of the vector to insert is critical to ensure efficient cloning. Successful cloning ratios may range from 1:1 to 1:10. For example, if the vector is 3 kb and the insert is 1 kb, one-third the amount of insert needs to be added to attain a 1:1 molar ratio.  

Alkaline Phosphatase (AP

 Alkaline Phosphatase (AP)


Alkaline Phosphatase is an important tool in molecular biological processes like cloning. It removes 3’- phosphate groups from a variety of substrates. Although in laboratory, it is used to catalyze the removal of terminal 5’-(P), residues from single stranded or double stranded DNA and RNA. The resulting 5’-OH termini can no longer take part in ligation reactions, thus prevents self religation of vectors, reducing the background of transformed bacterial colonies that carry empty plasmids. This enzyme works optimally at alkaline pH (range of 89 in the presence of low Zn+2 concentrations) and hence derived the name.  Alkaline Phosphatase is isolated from various sources:-

 a) Bacterial Alkaline phosphatase Secreted in monomeric form into the Periplasmic space of E.coli, where it form dimers and gets catalytically activated. It’s a remarkably stable enzyme and is resistant to inactivation by heat and detergent. Thus, bacterial alkaline phosphatase is the most difficult to destroy in the reaction mix.

b) Calf Intestinal Phosphatase  Calf intestinal phosphatase is a dimeric glycoprotein isolated from bovine intestine. This has much more practical significance than bacterial alkaline phosphatase, since it can be readily inactivated from the reaction mixture using proteinase K or by heating at 650C for 30 minutes or 750C for 15 minutes in the presence of 10mM EGTA.

c) Shrimp alkaline phosphatase Extracted from cold water shrimp, can be inactivated readily by heating at 650C for 15 min. 

what is Terminal Deoxy Nucleotidyl Transferase?


what is Terminal Deoxy Nucleotidyl Transferase ?

Terminal transferase is an unusual DNA polymerase found only in prelymphocytes and in early staqes of lymphoid differentiation. Synthesis of single stranded tails at the 3’ ends of either single stranded DNA or double stranded DNA with protruding 3’ termini, by the enzyme Terminal Deoxy Nucleotidyl Transferase, is called tailing, can be used to generate protruding ends of defined sequence to facilitate cloning of fragments. It can be used to generate protruding ends of defined sequence, e.g poly A tails on the 3’ ends of the DNA insert and poly T tails on 3’ ends of the vector. Thus, the protruding ends of the DNA insert and vector will base pair under appropriate annealing conditions. Mg2+ cation is preferred when the nucleotide to be added is a purine while Co2+ is preferred for the addition of pyrimidines. The enzyme strongly prefers DNA with protruding 3’ terminus, although blunt or recessed 3’ termini are also used, but less efficiently, in buffers of low ionic strength with Co2+, Mg2+ or Mn2+ as bivalent cations. As many as thousands of deoxynucleotides can be incorporated using this enzyme on a template of DNA. Single nucleotide can be added to the 3’ termini of DNA if modified bases like dideoxynucleotides or cordycepin triphosphates are used instead of natural deoxynucleotide triphosphates.

What is Screening, Genetic Tests and Counseling of Cancer?

What is Screening, Genetic Tests and Counseling of Cancer?

Early diagnosis of cancer greatly increases survival; therefore, regular exams for cancer can help to prevent deaths from cancer. These include mammograms and Pap tests for women, prostate cancer tests for men, colonoscopy exams for colon cancer, and regular physical exams for other types of cancer. Individuals with a strong family history of cancer should consider genetic tests for cancer and cancer risk counseling. The focus of cancer risk counseling is the individual’s personal risk of developing cancer and appropriate actions based on that risk. The discovery of the BRCA1and BRCA2genes associated with early development of breast cancer has allowed women with a family history of early breast cancer to be tested for mutations in these genes. Only five to ten percent of breast cancers show evidence of inheritance. Of these, forty-five percent are associated with a mutation in BRCA1and thirty-five percent with BRCA2. The gene or genes for the remaining twenty percent are not yet known. If the BRCA1 and BRCA2test results are negative, there is no evidence that the woman will have breast cancer because of these mutations. However, she may get breast cancer because of somatic mutations in these or other genes. If the BRCA1 orBRCA2test is positive, other family members may be tested to determine whether the gene was inherited. If other family members are negative, then there is less chance of hereditary risk of this form of cancer, although the individual with the mutation does carry an increased risk of the disease. If the test is positive in other family members, there is an increased hereditary risk for breast cancer in that family. The absence of hereditary risk does not mean that there is no other risk for breast cancer. Decisions based on genetic tests can be very complicated. Individuals must be fully informed about the risks before they can make reasonable decisions. Genetic counselors are trained to help individuals make difficult decisions based on genetic tests. The cumulative risk of breast cancer to age seventy for a woman with a BRCA1mutation is about fifty-seven to eighty-five percent depending on whether she is in a high-risk family. Some women find the fear of cancer so disruptive to their lives that they choose mastectomy to prevent cancer. (This is called prophylactic mastectomy.) Similarly, women with BRCA1have a high lifetime risk of ovarian cancer, causing some of them to choose to have their ovaries removed. While these are difficult decisions, the availability of genetic information provides individuals with information that they can use to make such important medical decisions. A young woman with a strong family history of ovarian cancer might find by genetic testing that she does not have the BRCA1 mutation and should not consider removal of her ovaries.

What is Follicle in  Human fertilization? Development if follicle.

What is Follicle in  Human fertilization? Development if follicle.

Follicle cells (from sex cords) surround the Primary oocyte.

The Follicle is the oocyteplus follicle cells

Primordial follicle -follicle cellspartially surround oocyte

Primary follicle –follicle cells form a complete layer Follicle cells form gap junctions with the oocyteand produce Meiotic inhibitory factor.
Follicle cells are called granulosacells

Granulosacell  layer enclosed by the membranagranulosa, a basement membrane that acts as a barrier to capillaries.

Zona pellucidasecreted by oocyteand
follicle cells –with microvillarconnections between the two. 

Ovary cells form 2 more layers –theca interna, theca external.

Follicle Development

Secondary follicle –formation of the antrum(cavity) fluid filled, liquor folliculi Hormone production, androgens and estrogen.

Tertiary or Graffianfollicle–12 hours prior to ovulation.
cumulus oophorus= mound of cells that house the secondary oocyte.

Oogenesiscontrolled by cycles (Menstrual) of hormone release: Hypothalamus to gonadotropinreleasing hormone(GnRH) Anterior to  pituitary Gonadotropins, includesluteinizing hormone(LH)
and Follicle stimulating hormone(FSH)

Ovulation -tertiary follicle protrudes like a blister on the surface of the ovary –then bursts in response to LH and FSH.

Corpus Luteum–Follicle after ovulation –hormone producing Progessterone.

What is Bacteriophage Artificial Chromosomes (BACs) ?


What is Bacteriophage Artificial Chromosomes (BACs) ?

These plasmids are circular DNA molecules carrying conventional antibiotic resistance marker, origin of replication derived from the F factor of E.coli, an ATP driven helicase (repE) to facilitate DNA replication and three loci (parA, parB and parC) for proper partitioning of the plasmid to daughter cells. BAC vectors have no packing constraints and there is no fixed limit to the size of genomic DNA that they accept. Usually the size of DNA is approximately 120-kilo base pairs.  

what is Shuttle vector in gene cloning ?

What is Shuttle vector in gene cloning ?
Cloning of foreign DNA is usually carried out primarily in E.coli since the organism is most thoroughly studied. But subsequent work often requires the foreign segment to be delivered to different host cells like eukaryotes. A number of vectors are devised to satisfy this requirement. These vectors are termed as shuttle vectors. These vectors have origins of replication of various hosts. The also contain fragments of eukaryotic viruses to facilitate entry into the cell or expression or integration in the cell itself. Thus shuttle vectors allow DNA to be transferred between two different species where it can be propagated by utilizing both the origins of replication. Usually the origins of replication are derived from bacterial and eukaryotic systems. Shuttle vectors also carry antibiotic resistance genes, which are functional in eukaryotes e.g. Neomycin (G418), Hygromycin, Methotrexate etc. All the DNA manipulation and characterization are done in prokaryotic system and then the manipulated DNA is introduced into the eukaryotic systems for protein expression and functional analysis. Eukaryotic host systems are better for expression of protein for few reasons:
1. Proper folding of the protein to attain functional activity .
2. Posttranslational modification of proteins for which prokaryotes does not possess any machinery. The most conventional and convenient model system for expression of eukaryotic proteins is yeast, Pichia pastoris, which is both genetically and physiologically well characterized. 

Yeast Artificial Chromosome (YACs)

Yeast Artificial Chromosome (YACs)

These are linear DNA molecules similar to yeast chromosome. Recombinant YACs are made by ligating large fragments of genomic DNA and then the resultant plasmid is introduced into yeast by transformation. The vector carries selection marker, DNA sequences called as telomere, so that the product can be stabilized inside the yeast cell, an origin of replication called autonomous replication origin, ARS. Large size of DNA can be inserted into YAC vectors, usually between 250kilobases to 400kilobasepairs. Large size of mammalian genomic libraries is also made with approximately 1 megabasepairs of foreign inserts. Insertion of foreign DNA into the cloning site inactivates a mutant expressed in vector DNA and formation of red rather than white colonies by yeast strain is observed. Thus transformants are identified as red colonies, which grow in yeast that is mutant for TRP1 and URA3, which ensure that the cell has received an artificial chromosome and with both the telomeres since it is complimented for both the mutations. And the colony also contains foreign DNA because it is red in color.

Brief note about plant vector


What is plant vector ?

Plant Vectors

A vector is a circular DNA molecule capable of independent existence and replication within a host cell. In case of plants, Ti and Ri are the two most commonly used plasmids which are used as vectors. Plant cells as such do not possess any endogenous plasmids. But two plasmids called pTi and pRi, are present naturally in the bacteria, Agrobacterium tumefaciens and Agrobacterium rhizogenes, respectively. These plasmids provide a naturally occurring transformation system. A part of the plasmid DNA, called as T-DNA, is transferred into the genomes of most dicot and some monocot plants. pTi stands for tumor inducing plasmid and pRi stands for root inducing plasmid. The infection of Agrobacterium tumefaciens is mediated by transfer of a segment of pTi called as T-DNA into the plant cell. Various bacterial chromosomal genes, such as chvB, exo genes, cell genes, are concerned with the biosynthesis of cell attachment polysaccharides due to which the bacterial cells adhere firmly to the plant cells. While two chromosomal genes are expressed constitutively in bacterial cells that is expressed at all the times inside a cell, which are responsible for virulence associated aspects, Agrobacterium tumefaciens Ti plasmid produces tumor like growth from which roots / shots may sometimes be produced. The infected cells are able to grow in culture on a medium devoid of any growth regulator while uninfected normal plant cells need exogenous auxin or cytokinin. These plasmids also carry genes for IAA (Indole Acetic Acid - auxin) and cytokinin production which is the reason for indefinite growth on a growth regulator free culture medium. When pTi is introduced into Rhizobium trifolii, it gains the ability to produce galls and to utilize opines. The crown gall root cells also synthesize unique nitrogenous compounds called opines, which are not produced by normal plant cells, which are not infected, nor are they utilized. The infected cells use opines as their carbon and nitrogen source. The type of opine produced depends on the bacterial strain. Agrobacterium tunefaciens strain produces either octopine or nopaline which the Agrobacterium rhizogenes produce either agropine or mannopine.

Brief note about Ti-plasmid


Brief note about  Ti plasmid

=>
Ti plasmid is a large mega plasmid conjugative plasmid of ~200kb. pTi is lost when Agrobacterium is grown above 28oC, such cured bacteria do not induce crown galls that is, they become a virulent. pTi and pRi, although do not share sequence homology but are unique in following respects:- a) They contain some genes, which are located within their T-DNA which has regulatory sequences recognized by plant cells, while their remaining genes have prokaryotic regulatory sequences. As a result, the former are expressed only in plant cells but not in the Agrobacterium, while the latter are only expressed in the bacterium. b) These plasmids naturally transfer a part of their DNA, called as T-DNA, into host plant cells. The T-DNA usually contains following important functional regions.
1. T-DNA contains oncogenes and opine synthesis genes and is transferred into host plant.
2. Vir region which regulates the transfer of T-DNA
3. Opine catabolism genes for utilization of opines.
4. Origin of replication for propagation in Agrobacterium. The T-DNA contains a 24bp direct repeat border sequence and contains the genes necessary for tumor / possess gene for auxin and cytokinin biosynthesis. All the genes present in TDNA have eukaryotic regulatory sequences. As a result, these genes are expressed only in plant cells but never express in Agrobacterium. The vir region mediates the transfer of TDNA into plant genomes and hence is essential for virulence. The genes of vir region are not transferred but induce the transfer of T-DNA. Also, the genes present in T-DNA are not responsible for its transfer, but the 24 bp direct repeat at both the left and right ends of TDNA is essential for the transfer. The exact mechanism of transfer of T-DNA is not known clearly known but is brought by the vir region. The phenols produced by wounded plant tissue initiates the transfer process. The T-DNA is transferred into the plant cells as single stranded DNA, which increases the efficiency of its transformation. But, as soon as it enters into the plant cell, it is immediately converted into a double stranded form. This form integrates at random sites in the host plant genome by a phenomenon called illegitimate recombination, which are due to sequence of homology in short segments of the host DNA. This integration is usually in low copy numbers. Few vectors are derived from pTi (wild type) due to some problems posed by wild type plasmid eg. The presence of oncogenes causes a disorganized growth, their large size and lack of cloning sites within the T-DNA, which are needed for the insertion of DNA segments that has to be cloned. 

What is Disarming ? Or removal of oncogenes from T-DNA into plant cell. & What is the Common Method of gene trnasfar

What is Disarming ? Or removal of oncogenes from T-DNA into plant cell.

What is the Common Method of gene transfar?

Disarming is the removal of oncogenes from T-DNA and it has resolved many problems. This disarmed plasmid can still transfer its T-DNA into plant cells. But the cells containing this modified T-DNA will be non tumorous, produce opines and generate plantlets. Only the border sequences are necessary for the transfer of any DNA insert placed between them. Thus pTi and pRi which are disarmed are more in use for gene transfer experiments. But in some plants, the efficiency of transformation by disarmed pTi is much lower than the wild type pTi.  Introduction of DNA into plant cells without the involvement of a biological agent like Agrobacterium leading to a stable transformation is known as Direct Gene Transfer. The spontaneous uptake of DNA is quite low.

The various methods those are utilized for direct gene transfer are

1. Chemical methods like PEG, Calcium phosphate
2. Electroporation
3. Particle gun delivery
4. Lipofection
5. Microinjection and Macroinjection

Application of klenow fragment in Molecular Biology

Application of Klenow fragment in Molecular Biology

1. Synthesis of double stranded DNA from single stranded template The primary function of DNA polymerase is to synthesize complimentary strands during DNA replication. DNA polymerase requires a primer to provide 3’–OH group to which newer nucleotides can be added. The primers used are generally 6-20 bases in length, termed as oligonucleotides, which are complimentary to a specific region of template DNA.

Shown below is the display of the catalytic activity carried out by the enzyme.

GCTAC                              AGGC AAGTCCGATGCCAATTGCGGATCCGATT

                       Klenow fragment       |||                 dNTPs of each kind                                                    |||
                                                           |||
                                                        \\||//
                                                          \ /

                     GCTACGGTTAACGCCTAGGCTAA              AAGTCCGATGCCAATTGCGGATCCGATT

2. Filling in recessed 3’ends of DNA fragments Klenow fragment is also used to create blunt ends on fragments created by restriction enzymes that leave 5’ overhangs. Klenow and dNTPs of             5’AGGCAG3’                       
3’TCCGTCGAACT5’                           |||                                                                                   || klenow fragment
                                                           |||
                                                        \\||//
                                                          \ /                       

                            5’AGGCAGCTTGA3’
                            3’TCCGTCGAACT5’

This is another way of producing blunt ends on a DNA, which is created by restriction enzymes that produce 3’ overhangs. Removal of nucleotides from 3’ ends will continue, but in the presence of nucleotides, the polymerase activity balances the exonuclease activity, yielding blunt ends.

4. Generating novel cohesive ends The DNA digested with restriction enzymes generates cohesive ends that can be end-filled. The end-filling reaction can be controlled by omitting one, two or three of the four dNTPs from the reaction and thereby generate partially filled termini.

What is the Conditions and requirements that influence Enzyme Activity for the use of Restriction Endonuclease at the time of treatment with plasmid ?

What is the Conditions and requirements that influence Enzyme Activity for the use of Restriction Endonuclease at the time of treatment with plasmid ?

One unit activity :-

it is defined as amount of enzyme required to digest 1µg of reference DNA in 60 minutes at 370C. Usually reference DNA is λ phage DNA.

Buffer:- 

The most critical determinant of the enzyme activity is the ionic concentration (NaCl content) of the buffer. There are commercially 3 buffer systems available for the activity, low salt buffer (20mM), medium (100mM) or high (250mM) NaCl buffers. The buffer is usually 10mM Tris-HCl, pH 8.0, supplemented with Magnesium salt (often 50mM MgCl2), a reducing agent (usually 1mM DTT), and some enzymes require BSA (100µg/ml) and salt (NaCl). The reaction does not require ATP.

Quality of DNA :-

Preparation of DNA that has to be cleaved should be free of contaminants such as phenol, CHCl3, alcohol, EDTA, detergents, excessive salts, protein, RNA, all of which can pose a hindrance to the enzyme’s activity.

Stopping a Reaction :

To terminate Restriction enzymes activity, heat inactivation is a way but for the enzymes which it does not work, phenol / CHCl3 extraction is another means of inactivation of Restriction enzymes.

Incubation Temperature and Time  : - 

Recommended temperature for most of the Restriction enzymes is 370C except for the ones which are isolated from thermophilic bacteria which require higher temperature ranging from 50-650C. While some restriction enzymes have short ½ lives at 370C and for those lower temperatures are required. Incubation time as per the unit definition is 1 hour but it can be manipulated. Example, it may be shortened if more units of Restriction enzyme is added or longer times are used to allow a reaction to proceed to completion with fewer enzymes units.

What is electrophoresis buffer ?

What is Electrophoresis buffer?

Several different buffers have been recommended for electrophoresis of DNA. The most commonly used for duplex DNA are TAE (Tris-acetateEDTA) and TBE (Tris-borate-EDTA). DNA fragments will migrate at somewhat different rates in these two buffers due to differences in ionic strength. Buffers not only establish a pH, but provide ions to support conductivity. If water is used instead of buffer there will be no migration of DNA in the gel and conversely, if concentrated buffer is used like a 10X solution instead of 1X, heat will be generated in the gel which is enough to melt it. 

What is Isochizomers

What is Isochizomers?

Isochizomers are different Restriction endonucleases having same recognition site. In some cases, they cut identically within their recognition site, but sometime they do not. They have different optimum reaction conditions, stabilities and cost that give us an option of what to purchase. Some Restriction endonucleases recognizes only one sequence but never other, called as Ambiguous Recognition Sequence. Eg. BamH I recognize GGATCC, while Hinf I recognizes a 5bp sequence, with an eligibility of sequence starting with GA and ending with TC and having any base in between GANTC. Some REs recognition site has a site for cleavage by other Restriction Endonuclease. e.g: BamH I site GGATCC have site recognized and cleaved by Sau3A I GATC. Thus all BamH I sites can consequently be cut by Sau3A I.

What is Ethidium bromide?

What is Ethidium bromide?

Answer- Ethidium bromide is a fluorescent dye that intercalates between bases of nucleic acids and allows very convenient detection of DNA fragments in gels. It is added to the DNA sample before loading to enable visualization of the fragments within the gel or can be added in the electrophoresis buffer. The binding of ethidium bromide to DNA alters its mass and rigidity, and therefore its mobility. 

What is phage virus ?

What is phage ?


PHAGE can also replicate via the Lysogenic cycle. The phage genome is integrated into the host chromosome and is inherited into the chromosomes of all daughter bacteria. This "prophage" can be induced to enter the lytic cycle and kill its host by a variety of stresses like UV light

What is the Bacteriophage?

What is Bacteriophage ?

Bacteriophages replicate via the lytic phase cycle and the phage genome is injected into the cell, phage genes are expressed and phage proteins and DNA are made, progeny phage are packaged, and the cell is lysed. Two genetically different phage that infect the same host cell may recombine during the lytic cycle

What is Recombinant DNA Technology in brief

What is a Recombinant DNA ?

DNA molecules constructed outside the living cells that is in vitro by joining natural or synthetic DNA segments that can replicate in a living cell.

What is the Goals of Recombinant DNA Technology?

a) To isolate and characterize a gene
b) To make desired alterations in one or more isolated genes
c) To return altered genes to living cells

What is Basic Tools of Recombinant DNA Technology?

Nucleic Acid Enzymes DNA and RNA polymerases, reverse transcriptase, DNA ligases, Restriction endonucleases and many more.

Tuesday, 5 July 2016

How to isolate a plasmid from a bacteria ?

How to isolate a plasmid from a bacteria ?

Plasmids are easily isolated from bacterial cells Plasmid isolation takes advantage of the unique structural properties of plasmids. Plasmids are small,super coiled circular pieces of Dana.Unlike the much larger bacterial chromosomes(which is also circular),plasmids are quite resistant to permanent den. Today,most laboratories use commercial kits for plea mid isolations,because the kits are convenient and relatively inexpensive.the kits give good yields of highway a little,while avoiding the need for organic denaturant ants.A variety of less expensive,but somewhat more time-consuming,procedure have been described for investigators who want to make their own reagents.These procedures generally give good yields of death at is slightly less pure in a purified with the kits.Whatever the isolation procedure,the general principles of plasmid isolation are the same.The figure and paragraphs below summarise regs general principles used for plasmid isolation.

1. Lysis and denaturation-
Strong denaturating conditions to weaken the tough bacterial drop wall.The most common procedures use a combination of strong base and a detergent.The detergents help to solubility lipids in the,allowing the denaturants to enter the cell. Proteins,because of their fragile structures,are irreversibly denatured.The treatment also breaks the hydrogen bonds holding together the chromosomal and plasmid DNA.
 2. Neutralization-
Neutralization allows complementary DNA strand store anneal and causes proteins to precipitate.Plasmids renature because they have super coiled structures that have held the two strands of the helix together denaturation.chromosomal DNA a is not able to renature,however,because it's longer strands have become mixed with denatured proteins. Samples must be mixed gently at this step to prevent fragmentation of the long, chromosomal DNA into pieces that might be able to reanneal and co-purify with the plasmids.  
3. centrifugal- 
on plasmid Dana is separated from large aggregates of precipitated protea chromosomal in a by centrifugal ion. 
4. Additional purification -
Plasmids are further purified by organic extraction or adsorption in resin.

What is plasmid DNA?

What is plasmid DNA?
=>
Plasmid is a double standed ,self replicating,extra chromosomal DNA Plasmids are cloning vectors that are widely used in molecularbiology andthey play an important roles in the laboratory.Plasmids are small, circular pieces of DNA  that replicate independently of the host chromosome.The first plasmids used in the lab were derivatives of naturally I occurring plasmids found in vacate.Since their discovery,molecularbiologists have added many features to plasmids to suit a variety of applications.In this lab,each team will I so late three plasmids from bacterial strains.
Plasmid DNA are red circular one

a short notes on Insulin of human body

                                       Human Insulin 


Human insulin is a globular protein with a molecular weight of about 5,800 kd, consisting of 51 aminoacid residues organised in two polypeptide chains (A and B), linked by two disulphide bonds. Chain A consists of 21 residues with an extra disulphide bond between A6 and A11; chain B consists of 30 aminoacids. Complete synthesis of the human insulin molecule was achieved in 196610. Insulin exists as a monomer only at low concentrations while it shows propensity to aggregate into stable dimers at higher concentrations, in aqueous solution at pH 2-8 and into hexamers in the presence of zinc ions. The hexamer, in which chain A constitutes much of the polar surface, is almost spherical in structure, with a diameter of 5 nm and a height of 3.5 nm. Polymerisation of the hormone has major pharmacological implications.

What Is Cancer?


 What Is Cancer?

=> Cancer results from a series of molecular events that fundamentally alter the normal properties of cells. In cancer cells the normal control systems that prevent cell overgrowth and the invasion of other tissues are disabled. These altered cells divide and grow in the presence of signals that normally inhibit cell growth; therefore, they no longer require special signals to induce cell growth and division. As these cells grow they develop new characteristics, including changes in cell structure, decreased cell adhesion, and production of new enzymes. These heritable changes allow the cell and its progeny to divide and grow, even in the presence of normal cells that typically inhibit the growth of nearby cells. Such changes allow the cancer cells to spread and invade other tissues. The abnormalities in cancer cells usually result from mutations in protein-encoding genes that regulate cell division. Over time more genes become mutated. This is often because the genes that make the proteins that normally repair DNA damage are themselves not functioning normally because they are also mutated. Consequently, mutations begin to increase in the cell, causing further abnormalities in that cell and the daughter cells. Some of these mutated cells die, but other alterations may give the abnormal cell a selective advantage that allows it to multiply much more rapidly than the normal cells. This enhanced growth describes most cancer cells, which have gained functions repressed in the normal, healthy cells. As long as these cells remain in their original location, they are considered benign; if they become invasive, they are considered malignant. Cancer cells in malignant tumors can often metastasize, sending cancer cells to distant sites in the body where new tumors may form.


What is a species?


What is a species?
=>
 The most common definition is based on the biological species concept. By this definition, individuals belong to the same species if they reproduce by mating with each other and are reproductively isolated from other such groups.

How to prepare ACETIC ACID- SODIUM ACETATE BUFFER?

(This is practical experiment)


How to prepare ACETIC ACID- SODIUM ACETATE BUFFER?

=>
 REAGENTS REQUIRED:  

Acetic Acid 0.2M: 1.5 ml of glacial acetic acid is made upto 100ml with     distilled water. 
Sodium Acetate Solution: 0.64 gm of sodium acetate or 2.72gm of sodium acetate trihydrate is dissolved in 100ml Distilled water. 

PROCEDURE: 

Pipette out exactly 36.2ml of sodium acetate solution into 100ml of standard flask and add 14.8ml of glacial acetic acid, make the volume 100ml using distilled water using distilled water. This gives 0.2 M of acetic acid and sodium acetate buffer. The pH is measured with pH meter.  
 pH meter is first standararised with pH buffer. Wash electrode with distilled water and introduced into 0.2M acetic acid-sodium acetate buffer prepared, the pH of solution is 4.6. 

 RESULT:  

36.2ml Sodium acetate and 14.8 ml glacial acetic acid were mixed and buffer was prepared. pH was measured initial reading observed was 4 which made upto 4.6 with 5N NaOH.   

How to prepare BARBITONE BUFFER?

(This is practical experiment)




How to prepare BARBITONE BUFFER?

  REAGENTS REQUIRED:

• Diethyl barbituric acid. 
• Sodium diethyl barbititrate 

PROCEDURE:   

Dissolve 2.85gm of diethyl barbituric acid and 14.2gm of sodium diethyl barbititrate in distilled water and upto 1 liter. This gives the barbitone buffer.  The pH meter is first standararised with pH buffer. Wash electrode with distilled water and introduced into barbitone buffer prepared, the pH of solution is 6.8. 

What is CITRATE BUFFER? How it to be made?

    (This is practical experiment)



What is CITRATE BUFFER? How it to be made?

  => 
REAGENT S REQUIRED: 
• Citric acid: Dissolve 2.101 gm of citric acid in 100ml distilled water.
 • Sodium citrate solution 0.1 M: Dissolved 2.941gm of sodium citrate in 100ml distilled water. 

PROCEDURE:  

46.5ml of citric acid with 3.5ml of sodium citrate solution  and upto 100ml with distilled water. It corresponds to 0.1 M citrate buffer and standardised with pH meter and measures the pH of the prepared solution. This gives citrate buffer at pH 2.5. 

RESULT: 
Citrate buffer was prepared and the pH observed was 4.8 which was adjusted to 2.5 using 1N Hcl and 5N NaoH.  

How to make CARBONATE- BICARBONATE BUFFER?

        ( This is a practical experiment)


How to make CARBONATE- BICARBONATE BUFFER?

=>
 REAGENTS REQUIRED:
 • Sodium carbonate solution 0.2M: Dissolve 2.12gm of anhydrous sodium carbonate in 100ml Distilled water.
 • Sodium bicarbonate solution: Dissolve 1.68gm of sodium bicarbonate in 100ml of distilled water.

PROCEDURE: 
Pipette out exactly 27.5ml of sodium carbonate (Na2Co3) solution. To this add 22.5ml of sodium bicarbonate solution and made upto 100ml with distilled water which corresponds to 0.2 M sodium carbonate and bicarbonate buffer. Standardise pH meter and measure the pH of required buffer. This gives the Carbonate- bicarbonate buffer pH 10.2. 

RESULT: 
Carbonate bicarbonate buffer was prepared and pH observed was 7.5 which was adjusted to 10.2 using 1N Hcl and 5N NaoH. 

How to make PHOSPHATE BUFFER?

How to make PHOSPHATE BUFFER?

  =>
REAGENTS REQUIRED:

• Monobasic: Dissolve 2.78gm of sodium dihydrogen phosphate in 100ml of distilled water.

• Dibasic sodium phosphate (0.2M): Dissolve 5.3gm of disodium hydrogen phosphate or 7.17 gm sodium hydrogen phosphate in 100ml distilled water.

PROCEDURE:
39 ml of dihydrogen sodium phosphate is mixed with 61 ml of disodium hydrogen phosphate This made up to 200ml with distilled water .This gives phosphate (Po4)2 buffer of 0.2M. Standardized pH meter with standard buffer. Washed electrode with distilled water and introduced it into phosphate buffer prepared. The pH of the solution is 6.8.

RESULT:
Phosphate buffer was prepared and pH was observed 8.5 which was made upto 6.8 using 1N Hcl and 5N NaoH. 

what is phosphatase?

What is phosphatase?

=>Phosphatases are enzymes that hydrolyze phosphate groups from a wide variety of organic substrates (phosphate esters), producing an alcohol and phosphoric acid. They are found in all cells and usually are classified as either acid phosphatases or alkaline phosphatases.  Phosphatases can be studied in crude cellular extracts or in pure form.

Substrate+Water+Enzyme=Product+Phosphoric acid+Enzyme 

what is enzyme?


  • What is ENZYMES?
  • How it work on body?   
  • => A complex protein produced by living cells that promotes a specific biochemical reaction by acting as a catalyst. Enzymes are catalysts, speeding up chemical reactions in cells, making reactions run to completion thousands if not millions of times more quickly than if the enzyme was absent. 
  •  For example, carbonic anhydrase, which functions in red blood cells, is an enzyme that converts 600,000 molecules of carbon dioxide to 600,000 molecules of bicarbonate in ONE second.
  •   The rate at which different enzymes convert substrate(s) to product(s) is highly variable, and this rate is also subject to change due to environmental conditions, such as temperature and the pH of the surrounding environment.  For example, rates of decomposition (a complex process whereby myriad chemical reactions occur, with associated enzymes) are much slower in colder climates than in warmer climates decomposition is also slowed if not stopped all together in the highly acidic environment of bogs. 
  • An enzyme works on a substrate, which is then turned into a product (or products).  In one of the examples above, carbonic anhydrase is the enzyme, carbon dioxide is the substrate it works on, and bicarbonate is the resulting product.  In text, enzymes are easily recognizable, as they usually end in the suffix –ase. 

What is the Fundamental Properties of Life?

What is the Fundamental Properties of Life?

=>all known organisms share certain general properties. To a large degree, these properties define what we mean by life. The following fundamental properties are shared by all organisms on earth.

Cellular organization-All organisms consist of one or more cells—complex, organized assemblages of molecules enclosed within membranes  Sensitivity.All organisms respond to stimuli— though not always to the same stimuli in the same ways.

Growth-All living things assimilate energy and use it to grow, a process called metabolism. Plants, algae, and some bacteria use sunlight to create covalent carboncarbon bonds from CO2and H2O through photosynthesis. This transfer of the energy in covalent bonds is essential to all life on earth.

Development-Multicellular organisms undergo systematic gene-directed changes as they grow and mature.

Reproduction-All living things reproduce, passing on traits from one generation to the next. Although some organisms live for a very long time, no organism lives forever, as far as we know. Because all organisms die, ongoing life is impossible without reproduction.

regulations- All organisms have regulatory mechanisms that coordinate internal processes.

Homeostasis- All living things maintain relatively constant internal conditions, different from their environment.
What is Biological diversity ??

=>Evolution results in a vast number of different adaptations for survival and reproduction. Life exists in many different forms in soils and on the surface of the land, in water and in the air. All species on earth have not yet been discovered. Fully 1.8 million species are known today. There may be as many as 100 million! About one million of currently known species are insects. There are at least 360,000 green plants. Another 75,000 are molluscs (octopi and squids, snails, mussels, etc.) Nearly 60,000 fungi have been scientifically described. Among the vertebrates, roughly 28,500ray-finned fishes, 10,000 birds, 8,000 reptiles and 5,000 mammals have been described. There are at least 4,000 species of red algae. Knowledge of species and their relationships to each other is essential to much biological research.
What Is Life?

=>Life is nothing but the compostion of hdrocarbon organic metrial .
All known organisms share certain general properties, and to a large degree these properties define what we mean by life.