Application of Klenow fragment in Molecular Biology
1. Synthesis of double stranded DNA from single stranded template The primary function of DNA polymerase is to synthesize complimentary strands during DNA replication. DNA polymerase requires a primer to provide 3’–OH group to which newer nucleotides can be added. The primers used are generally 6-20 bases in length, termed as oligonucleotides, which are complimentary to a specific region of template DNA.
Shown below is the display of the catalytic activity carried out by the enzyme.
GCTAC AGGC AAGTCCGATGCCAATTGCGGATCCGATT
Klenow fragment ||| dNTPs of each kind |||
|||
\\||//
\ /
GCTACGGTTAACGCCTAGGCTAA AAGTCCGATGCCAATTGCGGATCCGATT
2. Filling in recessed 3’ends of DNA fragments Klenow fragment is also used to create blunt ends on fragments created by restriction enzymes that leave 5’ overhangs. Klenow and dNTPs of 5’AGGCAG3’
3’TCCGTCGAACT5’ ||| || klenow fragment
|||
\\||//
\ /
5’AGGCAGCTTGA3’
3’TCCGTCGAACT5’
This is another way of producing blunt ends on a DNA, which is created by restriction enzymes that produce 3’ overhangs. Removal of nucleotides from 3’ ends will continue, but in the presence of nucleotides, the polymerase activity balances the exonuclease activity, yielding blunt ends.
4. Generating novel cohesive ends The DNA digested with restriction enzymes generates cohesive ends that can be end-filled. The end-filling reaction can be controlled by omitting one, two or three of the four dNTPs from the reaction and thereby generate partially filled termini.
No comments:
Post a Comment